JEB logo

Journal of Environmental Biology

pISSN: 0254-8704 ; eISSN: 2394-0379 ; CODEN: JEBIDP

About Journal
    Home
    Obituary: Dr. R. C. Dalela
    Editorial Board
    Reviewer Panel
    Publication Policies
    Guidelines for Editors
    Guidelines for Reviewers
    Abstracting and Indexing
    Subscription and Payments
    Contact Journal
    About Triveni Enterprises
 
Read Journal
    Current Issue
    Journal Archives
 
For Authors
    Guidelines for Authors
    Terms and Conditions
    Author Resources
    Fees and Payments
    Track Paper Status
 

Google Search the Journal web-site:


    Abstract - Issue Mar 2024, 45 (2)                                     Back


nstantaneous and historical temperature effects on a-pinene

Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India

 

R. Pervez1*, S.J. Eapen2 and S. Devasahayam2       

1Division of Nematology, ICAR-Indian Agricultural Research Institute, New Delhi-110 012, India

2Division of Crop Protection, ICAR-Indian Institute of Spices Research, Kozhikode-673 012, India

Received: 21 July 2022                   Revised: 16 August 2022                   Accepted: 25 November 2022

*Corresponding Author Email : rashidpervez2003@gmail.com                                    *ORCiD: https://orcid.org/0000-0002-2941-7606

 

 

 

Abstract

Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India.

Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'.

Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species.

Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected.

Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy

 

 

 

Copyright © 2024 Triveni Enterprises. All rights reserved. No part of the Journal can be reproduced in any form without prior permission. Responsibility regarding the authenticity of the data, and the acceptability of the conclusions enforced or derived, rest completely with the author(s).