|
Abstract
Aim:
To
identify the mealy bug samples collected from cassava plants and
identification of endosymbiotic bacteria associated with the mealy bugs
Methodology: Molecular
identification of mealy bugs was done using mitochondrial c y t o c h r o m e
o x i d a s e ( C O X - 1 ) C 1 - J - 2 1 8 3 F(CAACATTTATTTTGATTTTTTGG) and
CI-N-2568R (GCWACWACRTAATAKGTATCATG) primers. The molecular identification of
bacteria was done using 16S rRNA gene universal primers
Results: The mealy bug was
identified as F. virgata and the endosymbionts associated with mealy
bugs were identified as Lysinibacillus fusiformis and Bacillus cereus.
Interpretation: The endosymbionts
associated with the mealy bugs play significant role in completing lifecycle
of insects host and for providing nutrients to the host insects.
Key
words:
Cassava, Endosymbionts, Ferissia virgata, Mealybug
|