Journal of Environmental Biology

Molecular identification of endosymbiotic bacteria associated with Ferrisia virgata (Homoptera: Coccoidea: Pseudococcidae) infesting cassava (Manihot esculenta)

B.G. Sangeetha* and P. Drishya     

Division of Crop Protection, ICAR-Central Tuber Crops Research Institute, Thiruvananthapuram-695 017, India

Received: 24 August 2023                   Revised: 06 November 2023                   Accepted: 06 December  2023

*Corresponding Author Email : sangeethageethu214@gmail.com                          *ORCiD: https://orcid.org/0009-0004-5091-9530

Abstract

Aim: To identify the mealy bug samples collected from cassava plants and identification of endosymbiotic bacteria associated with the mealy bugs

Methodology: Molecular identification of mealy bugs was done using mitochondrial c y t o c h r o m e o x i d a s e ( C O X - 1 ) C 1 - J - 2 1 8 3 F(CAACATTTATTTTGATTTTTTGG) and CI-N-2568R (GCWACWACRTAATAKGTATCATG) primers. The molecular identification of bacteria was done using  16S rRNA gene universal primers

Results: The mealy bug was identified as F. virgata and the endosymbionts associated with mealy bugs were identified as Lysinibacillus fusiformis and Bacillus cereus.

Interpretation: The endosymbionts associated with the mealy bugs play significant role in completing lifecycle of insects host and for providing nutrients to the host insects.

Key words: Cassava, Endosymbionts, Ferissia virgata, Mealybug

Copyright © 2024 Triveni Enterprises. All rights reserved. No part of the Journal can be reproduced in any form without prior permission. Responsibility regarding the authenticity of the data, and the acceptability of the conclusions enforced or derived, rest completely with the author(s).